brookscash078 brookscash078
  • 03-05-2022
  • Mathematics
contestada

What is the surface area of the cylinder with height 4 km and radius 5 km?

Respuesta :

megkpeg megkpeg
  • 03-05-2022
The answer would 282.74km²
Answer Link

Otras preguntas

what rule does static electricity follow
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
Is 5/7 greater than 4/6
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
define concentric circles
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.