rianne1328 rianne1328
  • 03-11-2021
  • Social Studies
contestada

what is the most familiar symbol associated with day of the dead?

Respuesta :

evlina82 evlina82
  • 03-11-2021
Most familiar symbol is the Sugar skull
Answer Link
kaykaymartin
kaykaymartin kaykaymartin
  • 03-11-2021
Skeletons skulls flowers butterflies dogs ofrendas paper picado … stuff like that
Answer Link

Otras preguntas

Ways bionics can repair the human body in essay format (body paragraph)
which probe should be used to check the temperature of a chicken breast?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
3(k+9)=8-(-3k-19) solution types a. no solutionb. infinitely many solutions ?​
hello this isnt a question im just want to say there is a person thats username is pdmurphy all they do is copy other peoples answers most of the time then writ
who is prime ministerof nepal ?​
Culture is the sum of the___and___ that a group of people share. A. Location;resources B. Beliefs;behaviors C. Museums;opera D. Clothing;food help me pls
which type of encoding involves relating new information to existing knowledge that you already have stored in long-term memory?
Please help I will give brainliest to who ever answers it
Giải giúp e với ạaaaaaaaaaaa