antoniojose2 antoniojose2

02-06-2021
Mathematics

contestada

escreva na forma ax2+bx+c=0 as seguintes equações do 2° grau

Respuesta :

goat6978 goat6978

02-06-2021

The answer is 2x(5+3)

Answer Link

Otras preguntas

Mettez au futur proche : 1. Elle ________ (courir) à l’université. 2. Tu _______ (faire) tes travaux ? 3. Nous _______ (acheter) une bicyclette ? 4. Elles _____

Jerry's front porch is 7 feet wide and 13 feet long. Jerry wants to stain the wood on the porch next weekend. The stain costs $2.00 per square foot. How much wi

Before the advance-purchase deadline, the cost of attending a particular event is $46.32. After that, the price increases 37.5%. What is the cost then?

What percentage of the atoms in the same sample of plutonium-238 will have changed to another isotope after 263.1 years?

people go with my mett code yhv-ehoo-tji

HELPPPPPPPPPPPPPPPP MEEEEEEEEEEEEEEE YOU'LL GET BRAINLIEST!

Follow the steps above and find c, the total of the payments, and the monthly payment. Choose the right answers. Joe Football buys a big-screen TV. The price, i

Raphael is having friends over for a party. He spends $5.95 on a gallon of ice cream and $0.54 each for 12 cookies. What is the total cost, in dollars and cents

the table below shows Camden's earning on the job.How long does it take him to make $375.25

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'