512946
512946 512946
  • 02-02-2021
  • Mathematics
contestada

Please answer correctly. Thank you.

Please answer correctly Thank you class=

Respuesta :

ns5492
ns5492 ns5492
  • 02-02-2021

Answer:

C. A 70 angle

Step-by-step explanation:

Look at the angle thingy and it tells you

Answer Link
Kyleyeah
Kyleyeah Kyleyeah
  • 02-02-2021

Answer:

C

Step-by-step explanation:

Answer Link

Otras preguntas

When you prepare to make a left turn from a one-way road into a two-way road, you must:?
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)
Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
What is the value of x? x = 2 x = 3 x = 4 x = 6
why are the hindlimbs important on the frog
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
As a result of the educational reforms enacted in 1984, Texas schools offered A. lighter class loads. B. smaller class sizes. C. fewer assessment tests. D
In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co
what is the answer and what does tan a mean